Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7656828
End position: 7656851
Length: 24

DNA sequence
>NC_021177, from 7656828 to 7656851 (24 bp); Streptomyces fulvissimus DSM 40593 CACGGCCAGGGCCACGGCCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7656139-7657179	Sequence	SFUL_6808 - ABC transporter permease (Protein is coded in complementary strand; from 7657179 to 7656139)