Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7636997
End position: 7637036
Length: 40

DNA sequence
>NC_021177, from 7636997 to 7637036 (40 bp); Streptomyces fulvissimus DSM 40593 GGGCCTACCGGCCTACCGGCCTACGGGCCTACGGGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7637026-7637538	Sequence	SFUL_6790 - Cupin 2 conserved barrel domain protein (Protein is coded in complementary strand; from 7637538 to 7637026)