Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7545333
End position: 7545359
Length: 27

DNA sequence
>NC_021177, from 7545333 to 7545359 (27 bp); Streptomyces fulvissimus DSM 40593 GGTGGGACGGGTGGGACTGGTCGGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7545314-7546201	Sequence	SFUL_6706 - hypothetical protein (Protein is coded in complementary strand; from 7546201 to 7545314)