Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 75261
End position: 75305
Length: 45

DNA sequence
>NC_021177, from 75261 to 75305 (45 bp); Streptomyces fulvissimus DSM 40593 GGCGTCGACTCGGTCGGAGTCGGCTCGGTGGGGGTGGGCTCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 75036-75692	Sequence	SFUL_77 - LPXTG-motif cell wall anchor domain protein (Protein is coded in complementary strand; from 75692 to 75036)