Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7503452
End position: 7503481
Length: 30

DNA sequence
>NC_021177, from 7503452 to 7503481 (30 bp); Streptomyces fulvissimus DSM 40593 GTCGCCGTCGCCGTCGCCGTCGCCGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7502996-7503976	Sequence	SFUL_6669 - NUDIX hydrolase (Protein is coded in complementary strand; from 7503976 to 7502996)