Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7502650
End position: 7502682
Length: 33

DNA sequence
>NC_021177, from 7502650 to 7502682 (33 bp); Streptomyces fulvissimus DSM 40593 CGAACCGGGGCCGCCCCGGGGCCGCCCCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7502130-7502999	Sequence	SFUL_6667 - putative LmbE family-like protein (Protein is coded in complementary strand; from 7502999 to 7502130)