Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7456233
End position: 7456256
Length: 24

DNA sequence
>NC_021177, from 7456233 to 7456256 (24 bp); Streptomyces fulvissimus DSM 40593 CGGCGACTGCGACCGCGACGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7455677-7456309	Sequence	SFUL_6635 - hypothetical protein (Protein is coded in complementary strand; from 7456309 to 7455677)