Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7448576
End position: 7448600
Length: 25

DNA sequence
>NC_021177, from 7448576 to 7448600 (25 bp); Streptomyces fulvissimus DSM 40593 GGGCCGGGCCGGGCTTGGCCGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7448377-7448958	Sequence	SFUL_6628 - Regulatory protein TetR (Protein is coded in complementary strand; from 7448958 to 7448377)