Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7402092
End position: 7402115
Length: 24

DNA sequence
>NC_021177, from 7402092 to 7402115 (24 bp); Streptomyces fulvissimus DSM 40593 CTGGTCCCGGTCCTGGTCCTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7401631-7402128	Sequence	SFUL_6592 - hypothetical protein (Protein is coded in complementary strand; from 7402128 to 7401631)