Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7385887
End position: 7385916
Length: 30

DNA sequence
>NC_021177, from 7385887 to 7385916 (30 bp); Streptomyces fulvissimus DSM 40593 GTCGTCGTCCTCGTCGTCCTCGTCCTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7384208-7386484	Sequence	SFUL_6578 - chaperone (Protein is coded in complementary strand; from 7386484 to 7384208)