Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7383090
End position: 7383113
Length: 24

DNA sequence
>NC_021177, from 7383090 to 7383113 (24 bp); Streptomyces fulvissimus DSM 40593 GGCGGGGGAGGGGGCCGGGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7382752-7383540	Sequence	SFUL_6576 - FHA domain containing protein (Protein is coded in complementary strand; from 7383540 to 7382752)