Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7382394
End position: 7382420
Length: 27

DNA sequence
>NC_021177, from 7382394 to 7382420 (27 bp); Streptomyces fulvissimus DSM 40593 TCGGCGGGCTTGGCGGGCTCGACGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7379327-7382662	Sequence	SFUL_6575 - Putative serine/threonine protein kinase (Protein is coded in complementary strand; from 7382662 to 7379327)