Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7378850
End position: 7378879
Length: 30

DNA sequence
>NC_021177, from 7378850 to 7378879 (30 bp); Streptomyces fulvissimus DSM 40593 GCCCTCCCCCTCGCCCTCGCCGTCGTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7375311-7379330	Sequence	SFUL_6574 - CHAT domain containing protein (Protein is coded in complementary strand; from 7379330 to 7375311)