Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 737289
End position: 737312
Length: 24

DNA sequence
>NC_021177, from 737289 to 737312 (24 bp); Streptomyces fulvissimus DSM 40593 GGCCGTGGCGGTGGCCGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 736781-737473	Sequence	SFUL_624 - Phosphoesterase PA-phosphatase related protein