Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7238259
End position: 7238282
Length: 24

DNA sequence
>NC_021177, from 7238259 to 7238282 (24 bp); Streptomyces fulvissimus DSM 40593 CCCCCTCACCCTCCCGCTCCACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7237913-7238773	Sequence	SFUL_6448 - hypothetical protein (Protein is coded in complementary strand; from 7238773 to 7237913)