Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7212491
End position: 7212515
Length: 25

DNA sequence
>NC_021177, from 7212491 to 7212515 (25 bp); Streptomyces fulvissimus DSM 40593 GCCGCGCCGAGCAGCGCCGGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7211630-7212910	Sequence	SFUL_6421 - von Willebrand factor type A Precursor (Protein is coded in complementary strand; from 7212910 to 7211630)