Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7189052
End position: 7189075
Length: 24

DNA sequence
>NC_021177, from 7189052 to 7189075 (24 bp); Streptomyces fulvissimus DSM 40593 CGGGCCCGGGTCCGGACCAGGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7188808-7190730	Sequence	SFUL_6405 - Signal transduction histidine kinase (Protein is coded in complementary strand; from 7190730 to 7188808)