Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7170193
End position: 7170219
Length: 27

DNA sequence
>NC_021177, from 7170193 to 7170219 (27 bp); Streptomyces fulvissimus DSM 40593 CCGCCCGCACCGCGCGCACCGCCCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7169734-7170909	Sequence	SFUL_6388 - Xylose isomerase domain-containing protein TIM barrel