Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7142336
End position: 7142359
Length: 24

DNA sequence
>NC_021177, from 7142336 to 7142359 (24 bp); Streptomyces fulvissimus DSM 40593 CCGGCCGCCCCGCCGCCCGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7142116-7143018	Sequence	SFUL_6365 - NmrA family protein (Protein is coded in complementary strand; from 7143018 to 7142116)