Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7108879
End position: 7108938
Length: 60

DNA sequence
>NC_021177, from 7108879 to 7108938 (60 bp); Streptomyces fulvissimus DSM 40593 CGCCTCCCGCACCTCCGGCTCCCGCACTACCGGCTCCCGCACCTCCGGCTCCCGTACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7108838-7109824	Sequence	SFUL_6337 - Transcriptional regulator, LysR family (Protein is coded in complementary strand; from 7109824 to 7108838)