Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7043940
End position: 7043966
Length: 27

DNA sequence
>NC_021177, from 7043940 to 7043966 (27 bp); Streptomyces fulvissimus DSM 40593 GCCGGGTCGACCGGGTCGGCCGGGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7043748-7045415	Sequence	SFUL_6281 - AMP-dependent synthetase and ligase (Protein is coded in complementary strand; from 7045415 to 7043748)