Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 7043292
End position: 7043315
Length: 24

DNA sequence
>NC_021177, from 7043292 to 7043315 (24 bp); Streptomyces fulvissimus DSM 40593 CTCCGCCCCCGCCCCCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7042858-7043751	Sequence	SFUL_6280 - Nonactate synthase (Protein is coded in complementary strand; from 7043751 to 7042858)