Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6999387
End position: 6999410
Length: 24

DNA sequence
>NC_021177, from 6999387 to 6999410 (24 bp); Streptomyces fulvissimus DSM 40593 GTCCACGTCCAGCTCCACGTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6999229-7000272	Sequence	SFUL_6244 - Aln4 ketoreductase (Protein is coded in complementary strand; from 7000272 to 6999229)