Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6933729
End position: 6933764
Length: 36

DNA sequence
>NC_021177, from 6933729 to 6933764 (36 bp); Streptomyces fulvissimus DSM 40593 GCGCCGGAAACGCCGGAAACGCCGGAAACGCCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6933367-6934476	Sequence	SFUL_6191 - ABC transport system transmembrane protein