Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6852883
End position: 6852906
Length: 24

DNA sequence
>NC_021177, from 6852883 to 6852906 (24 bp); Streptomyces fulvissimus DSM 40593 CGGAGGCGGTGGCCGAGGCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6851022-6853430	Sequence	SFUL_6123 - Endonuclease/exonuclease/phosphatase (Protein is coded in complementary strand; from 6853430 to 6851022)