Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6821859
End position: 6821882
Length: 24

DNA sequence
>NC_021177, from 6821859 to 6821882 (24 bp); Streptomyces fulvissimus DSM 40593 GGTTCAGGGGTTCACGGGTTCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 6820117-6821859	Sequence	SFUL_6100 - Thiamine pyrophosphate protein domain protein TPP-binding protein
ORF... 6821879-6824998	Sequence	SFUL_6101 - Alpha-mannosidase (Protein is coded in complementary strand; from 6824998 to 6821879)