Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6709310
End position: 6709339
Length: 30

DNA sequence
>NC_021177, from 6709310 to 6709339 (30 bp); Streptomyces fulvissimus DSM 40593 CCTCGGTCCAGCTCGGTCCAGCTCAGTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6709333-6710898	Sequence	SFUL_5999 - Secreted protease (Protein is coded in complementary strand; from 6710898 to 6709333)