Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 666984
End position: 667008
Length: 25

DNA sequence
>NC_021177, from 666984 to 667008 (25 bp); Streptomyces fulvissimus DSM 40593 CGGGGCGGGGCGGTGCAGGGCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 666949-668073	Sequence	SFUL_554 - Protein serine/threonine phosphatase (Protein is coded in complementary strand; from 668073 to 666949)