Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6666107
End position: 6666130
Length: 24

DNA sequence
>NC_021177, from 6666107 to 6666130 (24 bp); Streptomyces fulvissimus DSM 40593 AGGCTGCGGCTGAGGCTGCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6665508-6666164	Sequence	SFUL_5968 - hypothetical protein (Protein is coded in complementary strand; from 6666164 to 6665508)