Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 666121
End position: 666165
Length: 45

DNA sequence
>NC_021177, from 666121 to 666165 (45 bp); Streptomyces fulvissimus DSM 40593 CGCCCGTCTTCCCGAGTGCCGTCTTCCCGAGTGCCGTCTTCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 666096-666494	Sequence	SFUL_552 - hypothetical protein (Protein is coded in complementary strand; from 666494 to 666096)