Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6651426
End position: 6651449
Length: 24

DNA sequence
>NC_021177, from 6651426 to 6651449 (24 bp); Streptomyces fulvissimus DSM 40593 GGCGAGGGCGACGCCGAGTGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6650599-6652725	Sequence	SFUL_5958 - Putative restriction enzyme (Protein is coded in complementary strand; from 6652725 to 6650599)