Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6613560
End position: 6613613
Length: 54

DNA sequence
>NC_021177, from 6613560 to 6613613 (54 bp); Streptomyces fulvissimus DSM 40593 CGGTGGGCCCGGTGGGACCGGTCGTCCCGGTGGGACCGGTCGTCCTGGTGGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6612521-6615964	Sequence	SFUL_5929 - Transcriptional regulator, SARP family protein