Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6611520
End position: 6611546
Length: 27

DNA sequence
>NC_021177, from 6611520 to 6611546 (27 bp); Streptomyces fulvissimus DSM 40593 CGCGGCGGGCGCCGCGGGCGCGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6610204-6611760	Sequence	SFUL_5927 - Secreted protein (Protein is coded in complementary strand; from 6611760 to 6610204)