Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6544217
End position: 6544243
Length: 27

DNA sequence
>NC_021177, from 6544217 to 6544243 (27 bp); Streptomyces fulvissimus DSM 40593 GCCACCAGCGCCAGCAGCGCCACCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6543308-6545059	Sequence	SFUL_5873 - Xenobiotic-transporting ATPase (Protein is coded in complementary strand; from 6545059 to 6543308)