Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6519190
End position: 6519234
Length: 45

DNA sequence
>NC_021177, from 6519190 to 6519234 (45 bp); Streptomyces fulvissimus DSM 40593 ACGGCACCCGGGGCACCAGCAGCCGGGGCACCAGCACCCGGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6518701-6520290	Sequence	SFUL_5852 - Transcriptional regulator, PucR family (Protein is coded in complementary strand; from 6520290 to 6518701)