Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6422791
End position: 6422853
Length: 63

DNA sequence
>NC_021177, from 6422791 to 6422853 (63 bp); Streptomyces fulvissimus DSM 40593 TCCCGCCGGTACGGTCCGAATGTCTGCCGGTACGGTCCGGATGCCCGTCGGTACGGTCCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6421539-6423005	Sequence	SFUL_5795 - Serine/threonine protein kinase (Protein is coded in complementary strand; from 6423005 to 6421539)