Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6290245
End position: 6290271
Length: 27

DNA sequence
>NC_021177, from 6290245 to 6290271 (27 bp); Streptomyces fulvissimus DSM 40593 CTCGGAGCGCTCGGAGCGCTCGGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6289478-6290512	Sequence	SFUL_5687 - Short chain dehydrogenase (Protein is coded in complementary strand; from 6290512 to 6289478)