Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 623910
End position: 623954
Length: 45

DNA sequence
>NC_021177, from 623910 to 623954 (45 bp); Streptomyces fulvissimus DSM 40593 TGTCGTGCACCGAGGCGTTCTGCACCGAGGTGTTCTCCACCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 622715-623950	Sequence	SFUL_521 - Cytochrome P-450 (Protein is coded in complementary strand; from 623950 to 622715)