Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6236004
End position: 6236033
Length: 30

DNA sequence
>NC_021177, from 6236004 to 6236033 (30 bp); Streptomyces fulvissimus DSM 40593 CGCCACCGCCATCGCCTCCGCCTCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6235211-6236452	Sequence	SFUL_5648 - Peptidase S8 and S53 subtilisin kexin sedolisin