Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6212487
End position: 6212510
Length: 24

DNA sequence
>NC_021177, from 6212487 to 6212510 (24 bp); Streptomyces fulvissimus DSM 40593 CCCACGCCCTCGCCCCCGGCCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6211179-6214859	Sequence	SFUL_5631 - Putative large Pro/Ala/Gly-rich protein