Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6156879
End position: 6156902
Length: 24

DNA sequence
>NC_021177, from 6156879 to 6156902 (24 bp); Streptomyces fulvissimus DSM 40593 GCCCTGGCCCGGGCGCTGGCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6156460-6157503	Sequence	SFUL_5583 - Fe(3+) ions import ATP-binding protein fbpC