Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6125686
End position: 6125739
Length: 54

DNA sequence
>NC_021177, from 6125686 to 6125739 (54 bp); Streptomyces fulvissimus DSM 40593 GGGCGGCCGGGGCGGCGGGGGCGCCGAGGGCGGCGGGGGCGGACGGGGTGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6125682-6126062	Sequence	SFUL_5545 - hypothetical protein (Protein is coded in complementary strand; from 6126062 to 6125682)