Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6106531
End position: 6106554
Length: 24

DNA sequence
>NC_021177, from 6106531 to 6106554 (24 bp); Streptomyces fulvissimus DSM 40593 CCGCCGCCCCCGTCGCCGCCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6105865-6106680	Sequence	SFUL_5517 - LigA protein (Protein is coded in complementary strand; from 6106680 to 6105865)