Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 608135
End position: 608158
Length: 24

DNA sequence
>NC_021177, from 608135 to 608158 (24 bp); Streptomyces fulvissimus DSM 40593 GCGTCGGCGTCCGGGTCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 608117-608806	Sequence	SFUL_509 - ArsR family transcriptional regulator (Protein is coded in complementary strand; from 608806 to 608117)