Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6044640
End position: 6044684
Length: 45

DNA sequence
>NC_021177, from 6044640 to 6044684 (45 bp); Streptomyces fulvissimus DSM 40593 AAGAAGGCCACGGCGAAGAAGGCGCCCGCGAAGAAGACCACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6044065-6044727	Sequence	SFUL_5450 - Histone family protein DNA-binding protein