Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 6033324
End position: 6033350
Length: 27

DNA sequence
>NC_021177, from 6033324 to 6033350 (27 bp); Streptomyces fulvissimus DSM 40593 GGCCCTGCTGGCCCTGCTGGCCCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6032267-6035716	Sequence	SFUL_5436 - Integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 6035716 to 6032267)