Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5926628
End position: 5926651
Length: 24

DNA sequence
>NC_021177, from 5926628 to 5926651 (24 bp); Streptomyces fulvissimus DSM 40593 GCCGAAGCGGAAGCCGAAGCCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5926616-5927374	Sequence	SFUL_5343 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 5927374 to 5926616)