Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5896675
End position: 5896698
Length: 24

DNA sequence
>NC_021177, from 5896675 to 5896698 (24 bp); Streptomyces fulvissimus DSM 40593 GAGGGCGAAGGCGAGGACGAGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5896625-5898058	Sequence	SFUL_5316 - Integral membrane transporter (Protein is coded in complementary strand; from 5898058 to 5896625)