Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5895796
End position: 5895849
Length: 54

DNA sequence
>NC_021177, from 5895796 to 5895849 (54 bp); Streptomyces fulvissimus DSM 40593 CCGGTCCCGGTTCGGGTTCCGGTCCCGGTTCGGGTTCCGGTCCCGGTTCGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5895309-5896628	Sequence	SFUL_5315 - Glycerate kinase (Protein is coded in complementary strand; from 5896628 to 5895309)