Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 5878431
End position: 5878475
Length: 45

DNA sequence
>NC_021177, from 5878431 to 5878475 (45 bp); Streptomyces fulvissimus DSM 40593 GGACCGGCTCCGGTCGTACGGGCTCCGGTCGTACGGGCTCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5877755-5879140	Sequence	SFUL_5303 - hydrolytic protein (Protein is coded in complementary strand; from 5879140 to 5877755)